Stem-loop sequence bta-mir-2285am

AccessionMI0032950 (change log)
DescriptionBos taurus miR-2285am stem-loop
Literature search

11 open access papers mention bta-mir-2285am
(15 sentences)

Stem-loop
   -                  a             -   ag 
5'  uggguuggccaaaaaguu guuuagguuuuuc gua  a
    |||||||||||||||||| ||||||||||||| |||   
3'  acccgaccgguuuuucaa uaaguccaaaaag uau  u
   a                  g             g   gg 
Get sequence
Deep sequencing
14396 reads, 201 reads per million, 77 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr22: 22009546-22009623 [-]
intergenic
Database links

Mature sequence bta-miR-2285am-5p

Accession MIMAT0040950
Sequence

11 - 

aaaaaguuaguuuagguuuuu

 - 31

Get sequence
Deep sequencing136 reads, 51 experiments
Evidence experimental; Illumina [1]

References

1
PMID:25458694 "Regulating life or death: potential role of microRNA in rescue of the corpus luteum" Maalouf SW, Liu WS, Albert I, Pate JL Mol Cell Endocrinol. 398:78-88(2014).