Stem-loop sequence bta-mir-2285al

AccessionMI0032949 (change log)
DescriptionBos taurus miR-2285al stem-loop
Literature search

11 open access papers mention bta-mir-2285al
(15 sentences)

Stem-loop
   -      a   -ac      ug  c       a    agu 
5'  uggguu gcc   aaaguu  uu ggguuuu cugu   a
    |||||| |||   ||||||  || ||||||| ||||    
3'  acccaa cgg   uuucaa  aa cccaaaa ggua   g
   g      c   guu      gu  a       a    cuc 
Get sequence
Deep sequencing
597 reads, 1.67 reads per million, 60 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr18: 5635713-5635792 [+]
intergenic
Database links

Mature sequence bta-miR-2285al-5p

Accession MIMAT0040949
Sequence

11 - 

acaaaguuuguucggguuuua

 - 31

Get sequence
Deep sequencing310 reads, 28 experiments
Evidence experimental; Illumina [1]

References

1
PMID:25458694 "Regulating life or death: potential role of microRNA in rescue of the corpus luteum" Maalouf SW, Liu WS, Albert I, Pate JL Mol Cell Endocrinol. 398:78-88(2014).