Stem-loop sequence bta-mir-2285ak

AccessionMI0032948 (change log)
DescriptionBos taurus miR-2285ak stem-loop
Literature search

11 open access papers mention bta-mir-2285ak
(15 sentences)

Stem-loop
   ca    u          c   c             ug 
5'   guug ccaaaagguu guu ggguuuuccugua  a
     |||| |||||||||| ||| |||||||||||||   
3'   caac gguuuucuaa caa cccaaaaggguau  u
   cc    c          a   a             ug 
Get sequence
Deep sequencing
6988 reads, 19.1 reads per million, 68 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr15: 29910520-29910595 [-]
intergenic
Database links

Mature sequence bta-miR-2285ak-5p

Accession MIMAT0040948
Sequence

11 - 

aaagguucguucggguuuuccu

 - 32

Get sequence
Deep sequencing6988 reads, 68 experiments
Evidence experimental; Illumina [1]

References

1
PMID:25458694 "Regulating life or death: potential role of microRNA in rescue of the corpus luteum" Maalouf SW, Liu WS, Albert I, Pate JL Mol Cell Endocrinol. 398:78-88(2014).