Stem-loop sequence bta-mir-2285aj

AccessionMI0032947 (change log)
DescriptionBos taurus miR-2285aj stem-loop
Literature search

11 open access papers mention bta-mir-2285aj
(15 sentences)

Stem-loop
   -   g  ug            g              gaac 
5'  uug gu  gcugaaaaguuc uuuggguuuuucca    a
    ||| ||  |||||||||||| ||||||||||||||     
3'  aac ca  cgacuuuuuaag aaaucuaaaaaggu    u
   u   a  gu            g              auuc 
Get sequence
Deep sequencing
170738 reads, 848 reads per million, 77 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr8: 72178646-72178726 [-]
intergenic
Database links

Mature sequence bta-miR-2285aj-5p

Accession MIMAT0040947
Sequence

11 - 

ugaaaaguucguuuggguuuuu

 - 32

Get sequence
Deep sequencing170738 reads, 77 experiments
Evidence experimental; Illumina [1]

References

1
PMID:25458694 "Regulating life or death: potential role of microRNA in rescue of the corpus luteum" Maalouf SW, Liu WS, Albert I, Pate JL Mol Cell Endocrinol. 398:78-88(2014).