Stem-loop sequence bta-mir-2285ai

AccessionMI0032946 (change log)
DescriptionBos taurus miR-2285ai stem-loop
Literature search

11 open access papers mention bta-mir-2285ai
(15 sentences)

Stem-loop
   -         ca   u       ug c      ca  cu 
5'  ugggucagc  aaa guucgcu  g uuuuuc  ua  a
    |||||||||  ||| |||||||  | ||||||  ||   
3'  accuagucg  uuu caaguga  c aaaaag  au  c
   a         ac   u       gu c      ac  uc 
Get sequence
Deep sequencing
556 reads, 0 reads per million, 66 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence bta-miR-2285ai-5p

Accession MIMAT0040946
Sequence

11 - 

aaaauguucgcuuggcuuuuu

 - 31

Get sequence
Deep sequencing93 reads, 45 experiments
Evidence experimental; Illumina [1]

References

1
PMID:25458694 "Regulating life or death: potential role of microRNA in rescue of the corpus luteum" Maalouf SW, Liu WS, Albert I, Pate JL Mol Cell Endocrinol. 398:78-88(2014).