Stem-loop sequence bta-mir-2285ah

AccessionMI0032945 (change log)
DescriptionBos taurus miR-2285ah stem-loop
Literature search

11 open access papers mention bta-mir-2285ah
(15 sentences)

Stem-loop
   ggacagagga    -      ag       g   --    cucu 
5'           uugg ggguag  gugggca gag  gggc    c
             |||| ||||||  ||||||| |||  ||||    c
3'           gacc ccuauc  cacccgu cuc  uccg    u
   --------gg    u      -g       g   uu    aacu 
Get sequence
Deep sequencing
41 reads, 0 reads per million, 25 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr7: 68298801-68298879 [+]
intergenic
Database links

Mature sequence bta-miR-2285ah-5p

Accession MIMAT0040945
Sequence

11 - 

uuggggguagaggugggcagga

 - 32

Get sequence
Deep sequencing15 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1
PMID:25458694 "Regulating life or death: potential role of microRNA in rescue of the corpus luteum" Maalouf SW, Liu WS, Albert I, Pate JL Mol Cell Endocrinol. 398:78-88(2014).