Stem-loop sequence bta-mir-668

AccessionMI0032937 (change log)
DescriptionBos taurus miR-668 stem-loop
Literature search

2 open access papers mention bta-mir-668
(7 sentences)

Stem-loop
   cgagcgggagucaccccugcuua     agu   uc        g     aauga 
5'                        gggua   gug  ucggguga caugc     a
                          |||||   |||  |||||||| |||||     c
3'                        cccau   cac  ggcucacu guacg     g
   -------------cuuguuagaa     ---   cc        -     cucgu 
Get sequence
Deep sequencing
101 reads, 4.55 reads per million, 44 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr21: 67872162-67872257 [+]
intergenic
Clustered miRNAs
< 10kb from bta-mir-668
bta-mir-539chr21: 67862745-67862822 [+]
bta-mir-544achr21: 67864731-67864821 [+]
bta-mir-655chr21: 67865688-67865784 [+]
bta-mir-411cchr21: 67867851-67867924 [+]
bta-mir-487achr21: 67868237-67868316 [+]
bta-mir-3578chr21: 67871246-67871331 [-]
bta-mir-382chr21: 67871251-67871326 [+]
bta-mir-134chr21: 67871630-67871702 [+]
bta-mir-668chr21: 67872162-67872257 [+]
bta-mir-485chr21: 67872328-67872400 [+]
bta-mir-453chr21: 67873059-67873138 [+]
bta-mir-154achr21: 67876412-67876495 [+]
bta-mir-154bchr21: 67876730-67876810 [+]
bta-mir-496chr21: 67877242-67877342 [+]
bta-mir-377chr21: 67878863-67878931 [+]
bta-mir-541chr21: 67880717-67880800 [+]
bta-mir-3957chr21: 67881103-67881179 [+]
bta-mir-409achr21: 67881619-67881697 [+]
bta-mir-409bchr21: 67881619-67881697 [-]
bta-mir-412chr21: 67881761-67881850 [+]
bta-mir-369chr21: 67881914-67881982 [+]
Database links

Mature sequence bta-miR-668-3p

Accession MIMAT0040936
Sequence

66 - 

augucacucggcccacuaccc

 - 86

Get sequence
Deep sequencing97 reads, 42 experiments
Evidence experimental; Illumina [1]

References

1
PMID:25458694 "Regulating life or death: potential role of microRNA in rescue of the corpus luteum" Maalouf SW, Liu WS, Albert I, Pate JL Mol Cell Endocrinol. 398:78-88(2014).