Stem-loop sequence bta-mir-323b

AccessionMI0032936 (change log)
DescriptionBos taurus miR-323b stem-loop
Stem-loop
   u      u            c     gccc  u  -   u 
5'  gaugcu gaggagagguug ccgug    gu cg cau c
    |||||| |||||||||||| |||||    || || ||| u
3'  cuaugg cuucucuccggc ggcac    ca gc gua u
   -      -            u     auaa  c  a   c 
Get sequence
Deep sequencing
202 reads, 0 reads per million, 49 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr21: 67882753-67882832 [+]
intergenic
Clustered miRNAs
< 10kb from bta-mir-323b
bta-mir-453chr21: 67873059-67873138 [+]
bta-mir-154achr21: 67876412-67876495 [+]
bta-mir-154bchr21: 67876730-67876810 [+]
bta-mir-496chr21: 67877242-67877342 [+]
bta-mir-377chr21: 67878863-67878931 [+]
bta-mir-541chr21: 67880717-67880800 [+]
bta-mir-3957chr21: 67881103-67881179 [+]
bta-mir-409achr21: 67881619-67881697 [+]
bta-mir-409bchr21: 67881619-67881697 [-]
bta-mir-412chr21: 67881761-67881850 [+]
bta-mir-369chr21: 67881914-67881982 [+]
bta-mir-410chr21: 67882238-67882318 [+]
bta-mir-323bchr21: 67882753-67882832 [+]
bta-mir-656chr21: 67883062-67883140 [+]
Database links

Mature sequence bta-miR-323b-3p

Accession MIMAT0040935
Sequence

50 - 

cacaauacacggucggccucu

 - 70

Get sequence
Deep sequencing201 reads, 49 experiments
Evidence experimental; Illumina [1]

References

1
PMID:25458694 "Regulating life or death: potential role of microRNA in rescue of the corpus luteum" Maalouf SW, Liu WS, Albert I, Pate JL Mol Cell Endocrinol. 398:78-88(2014).