Stem-loop sequence bta-mir-219b

AccessionMI0032929 (change log)
DescriptionBos taurus miR-219b stem-loop
Literature search

4 open access papers mention bta-mir-219b
(6 sentences)

Stem-loop
   a     ca     a   -      c a       ------------   u 
5'  gagcu  gccac gau guccag c caauucu            cgg u
    |||||  ||||| ||| |||||| | |||||||            |||  
3'  cucga  cggug cua cagguu g guuaaga            gcc g
   -     ag     a   a      u c       acaugcucagac   g 
Get sequence
Deep sequencing
521 reads, 0 reads per million, 36 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr11: 99257288-99257375 [+]
intergenic
Clustered miRNAs
< 10kb from bta-mir-219b
bta-mir-219-1chr11: 99257286-99257381 [-]
bta-mir-219bchr11: 99257288-99257375 [+]
Database links

Mature sequence bta-miR-219b-3p

Accession MIMAT0040926
Sequence

56 - 

agaauugcguuuggacaaucagu

 - 78

Get sequence
Deep sequencing506 reads, 34 experiments
Evidence experimental; Illumina [1]

References

1
PMID:25458694 "Regulating life or death: potential role of microRNA in rescue of the corpus luteum" Maalouf SW, Liu WS, Albert I, Pate JL Mol Cell Endocrinol. 398:78-88(2014).