Stem-loop sequence bta-mir-7857-2

AccessionMI0032928 (change log)
DescriptionBos taurus miR-7857-2 stem-loop
Literature search

1 open access papers mention bta-mir-7857-2
(1 sentences)

Stem-loop
   cuauuga     ----      -        g   g u   a - u 
5'        gacau    agccag uuggggaa aau c guu c c u
          |||||    |||||| |||||||| ||| | ||| | | a
3'        uugua    ucgguc aaccucuu uua g cga g g g
   --ggccg     uuuc      c        g   g u   a a a 
Get sequence
Deep sequencing
681 reads, 0 reads per million, 61 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr23: 30983593-30983679 [-]
intergenic
Clustered miRNAs
< 10kb from bta-mir-7857-2
bta-mir-7857-2chr23: 30983593-30983679 [-]
bta-mir-7857-1chr23: 30973815-30973880 [+]
Database links

Mature sequence bta-miR-7857-5p

Accession MIMAT0030432
Sequence

11 - 

auagccaguuggggaagaaugc

 - 32

Get sequence
Deep sequencing486 reads, 50 experiments
Evidence experimental; Illumina [1]

Mature sequence bta-miR-7857-3p

Accession MIMAT0040925
Sequence

55 - 

auuguucuccaaccuggcucuuu

 - 77

Get sequence
Deep sequencing421 reads, 57 experiments
Evidence experimental; Illumina [1]

References

1
PMID:25458694 "Regulating life or death: potential role of microRNA in rescue of the corpus luteum" Maalouf SW, Liu WS, Albert I, Pate JL Mol Cell Endocrinol. 398:78-88(2014).