Stem-loop sequence bta-mir-2285ag

AccessionMI0032927 (change log)
DescriptionBos taurus miR-2285ag stem-loop
Literature search

11 open access papers mention bta-mir-2285ag
(15 sentences)

Stem-loop
   a                               gu      -   aa 
5'  aaauauuggguuggccaaaaaguuuauuugg  uuuuuu ugu  g
    |||||||||||||||||||||||||||||||  |||||| |||   
3'  uuuaugaccuaaucgguuuuucaagugaacc  aaaagg aua  a
   -                               ug      u   gu 
Get sequence
Deep sequencing
751 reads, 4.29 reads per million, 70 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr28: 10398806-10398897 [+]
intergenic
Database links

Mature sequence bta-miR-2285ag-3p

Accession MIMAT0040923
Sequence

61 - 

uccaagugaacuuuuuggcuaa

 - 82

Get sequence
Deep sequencing109 reads, 43 experiments
Evidence experimental; Illumina [1]

References

1
PMID:25458694 "Regulating life or death: potential role of microRNA in rescue of the corpus luteum" Maalouf SW, Liu WS, Albert I, Pate JL Mol Cell Endocrinol. 398:78-88(2014).