Stem-loop sequence pal-mir-668

AccessionMI0032660 (change log)
DescriptionPteropus alecto miR-668 stem-loop
Stem-loop
   -gua    c  cu       g     g   a 
5'     agug gu  cggguga caugc auu a
       |||| ||  ||||||| ||||| ||| a
3'     ucac cg  gcucacu guaug ugg g
   ccca    c  --       -     a   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM32557v1; GCA_000325575.1) Overlapping transcripts
KB031153.1: 22097745-22097805 [+]
intergenic
Clustered miRNAs
< 10kb from pal-mir-668
pal-mir-381KB031153.1: 22088438-22088496 [+]
pal-mir-487bKB031153.1: 22088954-22089011 [+]
pal-mir-889KB031153.1: 22090283-22090341 [+]
pal-mir-544KB031153.1: 22091066-22091122 [+]
pal-mir-3959KB031153.1: 22093968-22094021 [+]
pal-mir-487aKB031153.1: 22094380-22094437 [+]
pal-mir-382KB031153.1: 22096793-22096850 [+]
pal-mir-668KB031153.1: 22097745-22097805 [+]
pal-mir-485KB031153.1: 22097905-22097963 [+]
pal-mir-323bKB031153.1: 22098685-22098741 [+]
pal-mir-154bKB031153.1: 22102337-22102397 [+]
pal-mir-377KB031153.1: 22104473-22104532 [+]
pal-mir-541KB031153.1: 22106842-22106907 [+]
pal-mir-409KB031153.1: 22107743-22107796 [+]
Database links

Mature sequence pal-miR-668-5p

Accession MIMAT0040416
Sequence

1 - 

guaagugcgucucgggugagcaugc

 - 25

Get sequence
Evidence experimental; Illumina [1]

Mature sequence pal-miR-668-3p

Accession MIMAT0040417
Sequence

41 - 

augucacucggcccacuaccc

 - 61

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:25128405 "Characterisation of novel microRNAs in the Black flying fox (Pteropus alecto) by deep sequencing" Cowled C, Stewart CR, Likic VA, Friedlander MR, Tachedjian M, Jenkins KA, Tizard ML, Cottee P, Marsh GA, Zhou P, Baker ML, Bean AG, Wang LF BMC Genomics. 15:682(2014).