Stem-loop sequence pal-mir-1306

AccessionMI0032641 (change log)
DescriptionPteropus alecto miR-1306 stem-loop
Literature search

1 open access papers mention pal-mir-1306
(1 sentences)

Stem-loop
   gcgcugccccaugaacagucuc       uccccu  a        guga   a 
5'                       caccacc      gc aacgucca    ugc g
                         |||||||      || ||||||||    |||  
3'                       guggugg      cg uugcaggu    aug a
   -------------------gua       ---ucu  g        ---a   g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM32557v1; GCA_000325575.1) Overlapping transcripts
KB030791.1: 4872165-4872249 [-]
intergenic
Database links

Mature sequence pal-miR-1306-5p

Accession MIMAT0040381
Sequence

1 - 

gcgcugccccaugaacagucucc

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence pal-miR-1306-3p

Accession MIMAT0040382
Sequence

65 - 

acguuggcucugguggugaug

 - 85

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:25128405 "Characterisation of novel microRNAs in the Black flying fox (Pteropus alecto) by deep sequencing" Cowled C, Stewart CR, Likic VA, Friedlander MR, Tachedjian M, Jenkins KA, Tizard ML, Cottee P, Marsh GA, Zhou P, Baker ML, Bean AG, Wang LF BMC Genomics. 15:682(2014).