Stem-loop sequence pal-mir-656

AccessionMI0032634 (change log)
DescriptionPteropus alecto miR-656 stem-loop
Stem-loop
   --      c     ag       cuu  u 
5'   agguug cugug  guguuca   uc a
     |||||| |||||  |||||||   || u
3'   uccaac gacau  uauaagu   ag a
   uc      u     au       ---  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM32557v1; GCA_000325575.1) Overlapping transcripts
KB031153.1: 22109090-22109145 [+]
intergenic
Clustered miRNAs
< 10kb from pal-mir-656
pal-mir-154bKB031153.1: 22102337-22102397 [+]
pal-mir-377KB031153.1: 22104473-22104532 [+]
pal-mir-541KB031153.1: 22106842-22106907 [+]
pal-mir-409KB031153.1: 22107743-22107796 [+]
pal-mir-412KB031153.1: 22107880-22107934 [+]
pal-mir-369KB031153.1: 22108020-22108075 [+]
pal-mir-410KB031153.1: 22108342-22108397 [+]
pal-mir-656KB031153.1: 22109090-22109145 [+]
Database links

Mature sequence pal-miR-656-5p

Accession MIMAT0040367
Sequence

1 - 

agguugccugugagguguuca

 - 21

Get sequence
Evidence experimental; Illumina [1]

Mature sequence pal-miR-656-3p

Accession MIMAT0040368
Sequence

36 - 

aauauuauacagucaaccucu

 - 56

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:25128405 "Characterisation of novel microRNAs in the Black flying fox (Pteropus alecto) by deep sequencing" Cowled C, Stewart CR, Likic VA, Friedlander MR, Tachedjian M, Jenkins KA, Tizard ML, Cottee P, Marsh GA, Zhou P, Baker ML, Bean AG, Wang LF BMC Genomics. 15:682(2014).