Stem-loop sequence pal-mir-3085

AccessionMI0032633 (change log)
DescriptionPteropus alecto miR-3085 stem-loop
Stem-loop
   ---a  u     ucu ag      g   uu   u 
5'     gg gccau   g  ggccag agu  gau a
       || |||||   |  |||||| |||  ||| u
3'     cc cggua   c  ucgguc uca  cua g
   cucc  -     --u -g      -   --   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM32557v1; GCA_000325575.1) Overlapping transcripts
KB031155.1: 11070055-11070115 [+]
intergenic
Database links

Mature sequence pal-miR-3085-5p

Accession MIMAT0040365
Sequence

1 - 

aggugccauucugagggccaggagu

 - 25

Get sequence
Evidence experimental; Illumina [1]

Mature sequence pal-miR-3085-3p

Accession MIMAT0040366
Sequence

41 - 

ucuggcugcuauggcccccuc

 - 61

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:25128405 "Characterisation of novel microRNAs in the Black flying fox (Pteropus alecto) by deep sequencing" Cowled C, Stewart CR, Likic VA, Friedlander MR, Tachedjian M, Jenkins KA, Tizard ML, Cottee P, Marsh GA, Zhou P, Baker ML, Bean AG, Wang LF BMC Genomics. 15:682(2014).