Stem-loop sequence pal-mir-507

AccessionMI0032630 (change log)
DescriptionPteropus alecto miR-507 stem-loop
Literature search

1 open access papers mention pal-mir-507
(1 sentences)

Stem-loop
   --   uc    u      u     uagc 
5'   acu  aaga gugcca ucaug    u
     |||  |||| |||||| |||||     
3'   uga  uucu cacggu aguau    a
   ag   ga    c      u     uaaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM32557v1; GCA_000325575.1) Overlapping transcripts
KB030676.1: 1627757-1627812 [+]
intergenic
Clustered miRNAs
< 10kb from pal-mir-507
pal-mir-507KB030676.1: 1627757-1627812 [+]
pal-mir-506KB030676.1: 1628067-1628129 [+]
Database links

Mature sequence pal-miR-507-5p

Accession MIMAT0040359
Sequence

1 - 

acuucaagaugugccauucaug

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence pal-miR-507-3p

Accession MIMAT0040360
Sequence

35 - 

ugauuggcaccucuuagaguga

 - 56

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:25128405 "Characterisation of novel microRNAs in the Black flying fox (Pteropus alecto) by deep sequencing" Cowled C, Stewart CR, Likic VA, Friedlander MR, Tachedjian M, Jenkins KA, Tizard ML, Cottee P, Marsh GA, Zhou P, Baker ML, Bean AG, Wang LF BMC Genomics. 15:682(2014).