Stem-loop sequence pal-mir-513

AccessionMI0032616 (change log)
DescriptionPteropus alecto miR-513 stem-loop
Literature search

1 open access papers mention pal-mir-513
(2 sentences)

Stem-loop
   --     a                  aca 
5'   uucgc agaaggugucauucaugu   c
     ||||| ||||||||||||||||||    
3'   aagcg uuuuccgcgguaaguaua   u
   ag     a                  aaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM32557v1; GCA_000325575.1) Overlapping transcripts
KB030676.1: 1639365-1639422 [+]
intergenic
Database links

Mature sequence pal-miR-513-5p

Accession MIMAT0040331
Sequence

1 - 

uucgcaagaaggugucauucau

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence pal-miR-513-3p

Accession MIMAT0040332
Sequence

37 - 

gaauggcgccuuuuagcgaaga

 - 58

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:25128405 "Characterisation of novel microRNAs in the Black flying fox (Pteropus alecto) by deep sequencing" Cowled C, Stewart CR, Likic VA, Friedlander MR, Tachedjian M, Jenkins KA, Tizard ML, Cottee P, Marsh GA, Zhou P, Baker ML, Bean AG, Wang LF BMC Genomics. 15:682(2014).