Stem-loop sequence pal-mir-874

AccessionMI0032603 (change log)
DescriptionPteropus alecto miR-874 stem-loop
Literature search

1 open access papers mention pal-mir-874
(1 sentences)

Stem-loop
   --g   c   a  ca        a ag  ag 
5'    cgg ccc cg  ccagggua g  ag  u
      ||| ||| ||  |||||||| |  ||  c
3'    gcc ggg gc  ggucccgu c  uc  u
   uca   a   a  cc        - cu  ac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM32557v1; GCA_000325575.1) Overlapping transcripts
KB031114.1: 7230874-7230935 [+]
intergenic
Database links

Mature sequence pal-miR-874-5p

Accession MIMAT0040306
Sequence

1 - 

gcggccccacgcaccaggguaagag

 - 25

Get sequence
Evidence experimental; Illumina [1]

Mature sequence pal-miR-874-3p

Accession MIMAT0040307
Sequence

39 - 

cugcccuggcccgagggaccgacu

 - 62

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:25128405 "Characterisation of novel microRNAs in the Black flying fox (Pteropus alecto) by deep sequencing" Cowled C, Stewart CR, Likic VA, Friedlander MR, Tachedjian M, Jenkins KA, Tizard ML, Cottee P, Marsh GA, Zhou P, Baker ML, Bean AG, Wang LF BMC Genomics. 15:682(2014).