Stem-loop sequence pal-mir-154b

AccessionMI0032586 (change log)
DescriptionPteropus alecto miR-154b stem-loop
Stem-loop
   --       uc     -   c     - uuug 
5'   agagguc  ccaug aug guuca c    u
     |||||||  ||||| ||| ||||| |     
3'   uuuccag  gguac uac uaagu g    u
   uu       uu     a   -     a uuuu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM32557v1; GCA_000325575.1) Overlapping transcripts
KB031153.1: 22102337-22102397 [+]
intergenic
Clustered miRNAs
< 10kb from pal-mir-154b
pal-mir-3959KB031153.1: 22093968-22094021 [+]
pal-mir-487aKB031153.1: 22094380-22094437 [+]
pal-mir-382KB031153.1: 22096793-22096850 [+]
pal-mir-668KB031153.1: 22097745-22097805 [+]
pal-mir-485KB031153.1: 22097905-22097963 [+]
pal-mir-323bKB031153.1: 22098685-22098741 [+]
pal-mir-154bKB031153.1: 22102337-22102397 [+]
pal-mir-377KB031153.1: 22104473-22104532 [+]
pal-mir-541KB031153.1: 22106842-22106907 [+]
pal-mir-409KB031153.1: 22107743-22107796 [+]
pal-mir-412KB031153.1: 22107880-22107934 [+]
pal-mir-369KB031153.1: 22108020-22108075 [+]
pal-mir-410KB031153.1: 22108342-22108397 [+]
pal-mir-656KB031153.1: 22109090-22109145 [+]
Database links

Mature sequence pal-miR-154b-5p

Accession MIMAT0040275
Sequence

1 - 

agaggucucccaugaugcguuca

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence pal-miR-154b-3p

Accession MIMAT0040276
Sequence

39 - 

aaucauacaugguugaccuuuuu

 - 61

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:25128405 "Characterisation of novel microRNAs in the Black flying fox (Pteropus alecto) by deep sequencing" Cowled C, Stewart CR, Likic VA, Friedlander MR, Tachedjian M, Jenkins KA, Tizard ML, Cottee P, Marsh GA, Zhou P, Baker ML, Bean AG, Wang LF BMC Genomics. 15:682(2014).