Stem-loop sequence pal-mir-541

AccessionMI0032585 (change log)
DescriptionPteropus alecto miR-541 stem-loop
Literature search

1 open access papers mention pal-mir-541
(4 sentences)

Stem-loop
   --aa          c   g --       --  aa 
5'     gggguucugc guc g  ucccacu  gc  a
       |||||||||| ||| |  |||||||  ||  g
3'     cccuaagacg cgg u  aggguga  cg  u
   ucag          -   g gg       ga  cu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM32557v1; GCA_000325575.1) Overlapping transcripts
KB031153.1: 22106842-22106907 [+]
intergenic
Clustered miRNAs
< 10kb from pal-mir-541
pal-mir-668KB031153.1: 22097745-22097805 [+]
pal-mir-485KB031153.1: 22097905-22097963 [+]
pal-mir-323bKB031153.1: 22098685-22098741 [+]
pal-mir-154bKB031153.1: 22102337-22102397 [+]
pal-mir-377KB031153.1: 22104473-22104532 [+]
pal-mir-541KB031153.1: 22106842-22106907 [+]
pal-mir-409KB031153.1: 22107743-22107796 [+]
pal-mir-412KB031153.1: 22107880-22107934 [+]
pal-mir-369KB031153.1: 22108020-22108075 [+]
pal-mir-410KB031153.1: 22108342-22108397 [+]
pal-mir-656KB031153.1: 22109090-22109145 [+]
Database links

Mature sequence pal-miR-541-5p

Accession MIMAT0040273
Sequence

1 - 

aagggguucugccgucgguc

 - 20

Get sequence
Evidence experimental; Illumina [1]

Mature sequence pal-miR-541-3p

Accession MIMAT0040274
Sequence

48 - 

ugggcgcagaaucccgacu

 - 66

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:25128405 "Characterisation of novel microRNAs in the Black flying fox (Pteropus alecto) by deep sequencing" Cowled C, Stewart CR, Likic VA, Friedlander MR, Tachedjian M, Jenkins KA, Tizard ML, Cottee P, Marsh GA, Zhou P, Baker ML, Bean AG, Wang LF BMC Genomics. 15:682(2014).