Stem-loop sequence pal-mir-376d

AccessionMI0032551 (change log)
DescriptionPteropus alecto miR-376d stem-loop
Literature search

1 open access papers mention pal-mir-376d
(1 sentences)

Stem-loop
   --  a         u         --   g 
5'   gu gauuuuccu cuaugauua  cgu g
     || ||||||||| |||||||||  ||| u
3'   ca cuaaaagga gaugcuagu  gua u
   ug  c         -         ug   g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM32557v1; GCA_000325575.1) Overlapping transcripts
KB031153.1: 22084388-22084445 [+]
intergenic
Clustered miRNAs
< 10kb from pal-mir-376d
pal-mir-543KB031153.1: 22077011-22077068 [+]
pal-mir-495KB031153.1: 22078847-22078904 [+]
pal-mir-3958KB031153.1: 22080829-22080884 [+]
pal-mir-376cKB031153.1: 22084045-22084102 [+]
pal-mir-376dKB031153.1: 22084388-22084445 [+]
pal-mir-376bKB031153.1: 22084768-22084825 [+]
pal-mir-376aKB031153.1: 22085130-22085185 [+]
pal-mir-1185KB031153.1: 22086787-22086846 [+]
pal-mir-381KB031153.1: 22088438-22088496 [+]
pal-mir-487bKB031153.1: 22088954-22089011 [+]
pal-mir-889KB031153.1: 22090283-22090341 [+]
pal-mir-544KB031153.1: 22091066-22091122 [+]
pal-mir-3959KB031153.1: 22093968-22094021 [+]
pal-mir-487aKB031153.1: 22094380-22094437 [+]
Database links

Mature sequence pal-miR-376d-5p

Accession MIMAT0040208
Sequence

1 - 

guagauuuuccuucuaugauua

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence pal-miR-376d-3p

Accession MIMAT0040209
Sequence

38 - 

aucguagaggaaaauccacgu

 - 58

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:25128405 "Characterisation of novel microRNAs in the Black flying fox (Pteropus alecto) by deep sequencing" Cowled C, Stewart CR, Likic VA, Friedlander MR, Tachedjian M, Jenkins KA, Tizard ML, Cottee P, Marsh GA, Zhou P, Baker ML, Bean AG, Wang LF BMC Genomics. 15:682(2014).