Stem-loop sequence pal-mir-410

AccessionMI0032520 (change log)
DescriptionPteropus alecto miR-410 stem-loop
Stem-loop
   --    ug      a  a     - uuu 
5'   aggu  ucugug ug guucg c   a
     ||||  |||||| || ||||| |   u
3'   uccg  agacac au uaagc g   u
   ug    gu      a  a     a uaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM32557v1; GCA_000325575.1) Overlapping transcripts
KB031153.1: 22108342-22108397 [+]
intergenic
Clustered miRNAs
< 10kb from pal-mir-410
pal-mir-323bKB031153.1: 22098685-22098741 [+]
pal-mir-154bKB031153.1: 22102337-22102397 [+]
pal-mir-377KB031153.1: 22104473-22104532 [+]
pal-mir-541KB031153.1: 22106842-22106907 [+]
pal-mir-409KB031153.1: 22107743-22107796 [+]
pal-mir-412KB031153.1: 22107880-22107934 [+]
pal-mir-369KB031153.1: 22108020-22108075 [+]
pal-mir-410KB031153.1: 22108342-22108397 [+]
pal-mir-656KB031153.1: 22109090-22109145 [+]
Database links

Mature sequence pal-miR-410-5p

Accession MIMAT0040151
Sequence

1 - 

agguugucugugaugaguucg

 - 21

Get sequence
Evidence experimental; Illumina [1]

Mature sequence pal-miR-410-3p

Accession MIMAT0040152
Sequence

36 - 

aauauaacacagauggccugu

 - 56

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:25128405 "Characterisation of novel microRNAs in the Black flying fox (Pteropus alecto) by deep sequencing" Cowled C, Stewart CR, Likic VA, Friedlander MR, Tachedjian M, Jenkins KA, Tizard ML, Cottee P, Marsh GA, Zhou P, Baker ML, Bean AG, Wang LF BMC Genomics. 15:682(2014).