Stem-loop sequence pal-let-7c

AccessionMI0032514 (change log)
DescriptionPteropus alecto let-7c stem-loop
Literature search

1 open access papers mention pal-let-7c
(1 sentences)

Stem-loop
   --u   g   u             ua  g ua a 
5'    gag uag agguuguaugguu  ga u  c c
      ||| ||| |||||||||||||  || |  | c
3'    uuc auc uccaacaugucaa  uu a  g c
   ccu   g   u             --  g gg u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM32557v1; GCA_000325575.1) Overlapping transcripts
KB030499.1: 10578905-10578971 [+]
intergenic
Clustered miRNAs
< 10kb from pal-let-7c
pal-mir-99aKB030499.1: 10578171-10578230 [+]
pal-let-7cKB030499.1: 10578905-10578971 [+]
Database links

Mature sequence pal-let-7c-5p

Accession MIMAT0040140
Sequence

1 - 

ugagguaguagguuguaugguu

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence pal-let-7c-3p

Accession MIMAT0040141
Sequence

46 - 

cuguacaaccuucuagcuuucc

 - 67

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:25128405 "Characterisation of novel microRNAs in the Black flying fox (Pteropus alecto) by deep sequencing" Cowled C, Stewart CR, Likic VA, Friedlander MR, Tachedjian M, Jenkins KA, Tizard ML, Cottee P, Marsh GA, Zhou P, Baker ML, Bean AG, Wang LF BMC Genomics. 15:682(2014).