Stem-loop sequence pal-mir-323b

AccessionMI0032508 (change log)
DescriptionPteropus alecto miR-323b stem-loop
Stem-loop
   --      u     --g  a  ucg    g 
5'   agguug ccgug   ug gu   cauu u
     |||||| |||||   || ||   ||||  
3'   ucuagc ggcac   ac cg   guaa u
   uc      u     aua  c  -ua    u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM32557v1; GCA_000325575.1) Overlapping transcripts
KB031153.1: 22098685-22098741 [+]
intergenic
Clustered miRNAs
< 10kb from pal-mir-323b
pal-mir-487bKB031153.1: 22088954-22089011 [+]
pal-mir-889KB031153.1: 22090283-22090341 [+]
pal-mir-544KB031153.1: 22091066-22091122 [+]
pal-mir-3959KB031153.1: 22093968-22094021 [+]
pal-mir-487aKB031153.1: 22094380-22094437 [+]
pal-mir-382KB031153.1: 22096793-22096850 [+]
pal-mir-668KB031153.1: 22097745-22097805 [+]
pal-mir-485KB031153.1: 22097905-22097963 [+]
pal-mir-323bKB031153.1: 22098685-22098741 [+]
pal-mir-154bKB031153.1: 22102337-22102397 [+]
pal-mir-377KB031153.1: 22104473-22104532 [+]
pal-mir-541KB031153.1: 22106842-22106907 [+]
pal-mir-409KB031153.1: 22107743-22107796 [+]
pal-mir-412KB031153.1: 22107880-22107934 [+]
pal-mir-369KB031153.1: 22108020-22108075 [+]
pal-mir-410KB031153.1: 22108342-22108397 [+]
Database links

Mature sequence pal-miR-323b-5p

Accession MIMAT0040128
Sequence

1 - 

agguuguccguggugaguu

 - 19

Get sequence
Evidence experimental; Illumina [1]

Mature sequence pal-miR-323b-3p

Accession MIMAT0040129
Sequence

37 - 

cccaauacacggucgaucucu

 - 57

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:25128405 "Characterisation of novel microRNAs in the Black flying fox (Pteropus alecto) by deep sequencing" Cowled C, Stewart CR, Likic VA, Friedlander MR, Tachedjian M, Jenkins KA, Tizard ML, Cottee P, Marsh GA, Zhou P, Baker ML, Bean AG, Wang LF BMC Genomics. 15:682(2014).