Stem-loop sequence pal-mir-409

AccessionMI0032507 (change log)
DescriptionPteropus alecto miR-409 stem-loop
Stem-loop
   --a    ac         -    - auc 
5'    gguu  ccgagcaac uuug c   u
      ||||  ||||||||| |||| |    
3'    ccaa  ggcucguug aagc g   g
   ucc    gu         u    a cag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM32557v1; GCA_000325575.1) Overlapping transcripts
KB031153.1: 22107743-22107796 [+]
intergenic
Clustered miRNAs
< 10kb from pal-mir-409
pal-mir-668KB031153.1: 22097745-22097805 [+]
pal-mir-485KB031153.1: 22097905-22097963 [+]
pal-mir-323bKB031153.1: 22098685-22098741 [+]
pal-mir-154bKB031153.1: 22102337-22102397 [+]
pal-mir-377KB031153.1: 22104473-22104532 [+]
pal-mir-541KB031153.1: 22106842-22106907 [+]
pal-mir-409KB031153.1: 22107743-22107796 [+]
pal-mir-412KB031153.1: 22107880-22107934 [+]
pal-mir-369KB031153.1: 22108020-22108075 [+]
pal-mir-410KB031153.1: 22108342-22108397 [+]
pal-mir-656KB031153.1: 22109090-22109145 [+]
Database links

Mature sequence pal-miR-409-5p

Accession MIMAT0040126
Sequence

1 - 

agguuacccgagcaacuuugcau

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence pal-miR-409-3p

Accession MIMAT0040127
Sequence

33 - 

gaauguugcucggugaaccccu

 - 54

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:25128405 "Characterisation of novel microRNAs in the Black flying fox (Pteropus alecto) by deep sequencing" Cowled C, Stewart CR, Likic VA, Friedlander MR, Tachedjian M, Jenkins KA, Tizard ML, Cottee P, Marsh GA, Zhou P, Baker ML, Bean AG, Wang LF BMC Genomics. 15:682(2014).