Stem-loop sequence pal-mir-412

AccessionMI0032501 (change log)
DescriptionPteropus alecto miR-412 stem-loop
Stem-loop
   --    c      u   aa    -    u 
5'   uggu gaccag ugg  agua auug u
     |||| |||||| |||  |||| ||||  
3'   auca cugguc acu  ucau uaau u
   cg    c      c   --    g    c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM32557v1; GCA_000325575.1) Overlapping transcripts
KB031153.1: 22107880-22107934 [+]
intergenic
Clustered miRNAs
< 10kb from pal-mir-412
pal-mir-485KB031153.1: 22097905-22097963 [+]
pal-mir-323bKB031153.1: 22098685-22098741 [+]
pal-mir-154bKB031153.1: 22102337-22102397 [+]
pal-mir-377KB031153.1: 22104473-22104532 [+]
pal-mir-541KB031153.1: 22106842-22106907 [+]
pal-mir-409KB031153.1: 22107743-22107796 [+]
pal-mir-412KB031153.1: 22107880-22107934 [+]
pal-mir-369KB031153.1: 22108020-22108075 [+]
pal-mir-410KB031153.1: 22108342-22108397 [+]
pal-mir-656KB031153.1: 22109090-22109145 [+]
Database links

Mature sequence pal-miR-412-5p

Accession MIMAT0040114
Sequence

1 - 

uggucgaccaguuggaaaguaa

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence pal-miR-412-3p

Accession MIMAT0040115
Sequence

36 - 

acuucaccugguccacuagc

 - 55

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:25128405 "Characterisation of novel microRNAs in the Black flying fox (Pteropus alecto) by deep sequencing" Cowled C, Stewart CR, Likic VA, Friedlander MR, Tachedjian M, Jenkins KA, Tizard ML, Cottee P, Marsh GA, Zhou P, Baker ML, Bean AG, Wang LF BMC Genomics. 15:682(2014).