Stem-loop sequence pal-mir-34a

AccessionMI0032461 (change log)
DescriptionPteropus alecto miR-34a stem-loop
Literature search

1 open access papers mention pal-mir-34a
(1 sentences)

Stem-loop
   ---u        -   a          gugag  a 
5'     ggcagugu cuu gcugguuguu     ca u
       |||||||| ||| ||||||||||     ||  
3'     ccgucaua gaa cgacuaacga     gu g
   gauc        u   -          aggaa  g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM32557v1; GCA_000325575.1) Overlapping transcripts
KB030727.1: 6598143-6598209 [+]
intergenic
Database links

Mature sequence pal-miR-34a-5p

Accession MIMAT0040037
Sequence

1 - 

uggcagugucuuagcugguugu

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence pal-miR-34a-3p

Accession MIMAT0040038
Sequence

44 - 

caaucagcaaguauacugcccuag

 - 67

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:25128405 "Characterisation of novel microRNAs in the Black flying fox (Pteropus alecto) by deep sequencing" Cowled C, Stewart CR, Likic VA, Friedlander MR, Tachedjian M, Jenkins KA, Tizard ML, Cottee P, Marsh GA, Zhou P, Baker ML, Bean AG, Wang LF BMC Genomics. 15:682(2014).