Stem-loop sequence pal-mir-885

AccessionMI0032450 (change log)
DescriptionPteropus alecto miR-885 stem-loop
Literature search

1 open access papers mention pal-mir-885
(1 sentences)

Stem-loop
   -           a  -         cu 
5'  uccauuacacu cc cugccucuu  c
    ||||||||||| || |||||||||   
3'  aggugaugugg gg gacggagag  u
   g           -  u         ug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM32557v1; GCA_000325575.1) Overlapping transcripts
KB030947.1: 29827704-29827756 [-]
intergenic
Database links

Mature sequence pal-miR-885-5p

Accession MIMAT0040017
Sequence

1 - 

uccauuacacuacccugccucu

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence pal-miR-885-3p

Accession MIMAT0040018
Sequence

33 - 

aggcagugggguguaguggag

 - 53

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:25128405 "Characterisation of novel microRNAs in the Black flying fox (Pteropus alecto) by deep sequencing" Cowled C, Stewart CR, Likic VA, Friedlander MR, Tachedjian M, Jenkins KA, Tizard ML, Cottee P, Marsh GA, Zhou P, Baker ML, Bean AG, Wang LF BMC Genomics. 15:682(2014).