Stem-loop sequence pal-mir-337

AccessionMI0032449 (change log)
DescriptionPteropus alecto miR-337 stem-loop
Literature search

1 open access papers mention pal-mir-337
(1 sentences)

Stem-loop
   -    c   c     c   a    augcc 
5'  agaa ggc ucauc agg guug     a
    |||| ||| ||||| ||| ||||      
3'  ucuu ccg aguag ucc cgac     g
   u    u   u     a   g    ccauu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM32557v1; GCA_000325575.1) Overlapping transcripts
KB031153.1: 21946950-21947008 [+]
intergenic
Clustered miRNAs
< 10kb from pal-mir-337
pal-mir-493KB031153.1: 21940683-21940746 [+]
pal-mir-337KB031153.1: 21946950-21947008 [+]
pal-mir-665KB031153.1: 21947487-21947542 [+]
pal-mir-433KB031153.1: 21954516-21954589 [+]
pal-mir-127KB031153.1: 21955620-21955675 [+]
Database links

Mature sequence pal-miR-337-5p

Accession MIMAT0040015
Sequence

1 - 

agaacggccucauccaggaguug

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence pal-miR-337-3p

Accession MIMAT0040016
Sequence

39 - 

cgccuagaugaugccuuucuu

 - 59

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:25128405 "Characterisation of novel microRNAs in the Black flying fox (Pteropus alecto) by deep sequencing" Cowled C, Stewart CR, Likic VA, Friedlander MR, Tachedjian M, Jenkins KA, Tizard ML, Cottee P, Marsh GA, Zhou P, Baker ML, Bean AG, Wang LF BMC Genomics. 15:682(2014).