Stem-loop sequence pal-mir-506

AccessionMI0032407 (change log)
DescriptionPteropus alecto miR-506 stem-loop
Literature search

1 open access papers mention pal-mir-506
(6 sentences)

Stem-loop
   --            ca       c   acgu 
5'   uacucaggaagg  ucguuca aua    a
     ||||||||||||  ||||||| |||    g
3'   augagucuuucc  gguaagu uau    a
   ug            ac       a   aaau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM32557v1; GCA_000325575.1) Overlapping transcripts
KB030676.1: 1628067-1628129 [+]
intergenic
Clustered miRNAs
< 10kb from pal-mir-506
pal-mir-507KB030676.1: 1627757-1627812 [+]
pal-mir-506KB030676.1: 1628067-1628129 [+]
Database links

Mature sequence pal-miR-506-5p

Accession MIMAT0039933
Sequence

1 - 

uacucaggaaggcaucguuca

 - 21

Get sequence
Evidence experimental; Illumina [1]

Mature sequence pal-miR-506-3p

Accession MIMAT0039934
Sequence

43 - 

aauggcaccuuucugaguagu

 - 63

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:25128405 "Characterisation of novel microRNAs in the Black flying fox (Pteropus alecto) by deep sequencing" Cowled C, Stewart CR, Likic VA, Friedlander MR, Tachedjian M, Jenkins KA, Tizard ML, Cottee P, Marsh GA, Zhou P, Baker ML, Bean AG, Wang LF BMC Genomics. 15:682(2014).