Stem-loop sequence pal-mir-382

AccessionMI0032398 (change log)
DescriptionPteropus alecto miR-382 stem-loop
Stem-loop
   --gaa           ug      - uuu 
5'      guuguucgugg  gauucg c   a
        |||||||||||  |||||| |   c
3'      caacaggcacu  cuaagc g   u
   uuuca           ua      a uau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM32557v1; GCA_000325575.1) Overlapping transcripts
KB031153.1: 22096793-22096850 [+]
intergenic
Clustered miRNAs
< 10kb from pal-mir-382
pal-mir-381KB031153.1: 22088438-22088496 [+]
pal-mir-487bKB031153.1: 22088954-22089011 [+]
pal-mir-889KB031153.1: 22090283-22090341 [+]
pal-mir-544KB031153.1: 22091066-22091122 [+]
pal-mir-3959KB031153.1: 22093968-22094021 [+]
pal-mir-487aKB031153.1: 22094380-22094437 [+]
pal-mir-382KB031153.1: 22096793-22096850 [+]
pal-mir-668KB031153.1: 22097745-22097805 [+]
pal-mir-485KB031153.1: 22097905-22097963 [+]
pal-mir-323bKB031153.1: 22098685-22098741 [+]
pal-mir-154bKB031153.1: 22102337-22102397 [+]
pal-mir-377KB031153.1: 22104473-22104532 [+]
Database links

Mature sequence pal-miR-382-5p

Accession MIMAT0039915
Sequence

1 - 

gaaguuguucgugguggauucg

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence pal-miR-382-3p

Accession MIMAT0039916
Sequence

37 - 

aaucauucacggacaacacuuu

 - 58

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:25128405 "Characterisation of novel microRNAs in the Black flying fox (Pteropus alecto) by deep sequencing" Cowled C, Stewart CR, Likic VA, Friedlander MR, Tachedjian M, Jenkins KA, Tizard ML, Cottee P, Marsh GA, Zhou P, Baker ML, Bean AG, Wang LF BMC Genomics. 15:682(2014).