Stem-loop sequence pal-mir-99a

AccessionMI0032360 (change log)
DescriptionPteropus alecto miR-99a stem-loop
Stem-loop
   ---a         uc   u      g  aag 
5'     acccguaga  cga cuugug ug   u
       |||||||||  ||| |||||| ||    
3'     uggguaucu  gcu gaacac gc   g
   uguc         uc   c      -  cag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM32557v1; GCA_000325575.1) Overlapping transcripts
KB030499.1: 10578171-10578230 [+]
intergenic
Clustered miRNAs
< 10kb from pal-mir-99a
pal-mir-99aKB030499.1: 10578171-10578230 [+]
pal-let-7cKB030499.1: 10578905-10578971 [+]
Database links

Mature sequence pal-miR-99a-5p

Accession MIMAT0039848
Sequence

1 - 

aacccguagauccgaucuugu

 - 21

Get sequence
Evidence experimental; Illumina [1]

Mature sequence pal-miR-99a-3p

Accession MIMAT0039849
Sequence

38 - 

caagcucgcuucuaugggucugu

 - 60

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:25128405 "Characterisation of novel microRNAs in the Black flying fox (Pteropus alecto) by deep sequencing" Cowled C, Stewart CR, Likic VA, Friedlander MR, Tachedjian M, Jenkins KA, Tizard ML, Cottee P, Marsh GA, Zhou P, Baker ML, Bean AG, Wang LF BMC Genomics. 15:682(2014).