Stem-loop sequence pal-mir-215

AccessionMI0032350 (change log)
DescriptionPteropus alecto miR-215 stem-loop
Stem-loop
   -a  a     -   uc        g   ag 
5'   ug ccuau gaa  gacagaca uau  u
     || ||||| |||  |||||||| |||   
3'   ac ggaua cuu  cugucugu gug  c
   ua  c     u   ua        -   aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM32557v1; GCA_000325575.1) Overlapping transcripts
KB030861.1: 7895162-7895220 [-]
intergenic
Clustered miRNAs
< 10kb from pal-mir-215
pal-mir-194aKB030861.1: 7895811-7895868 [-]
pal-mir-215KB030861.1: 7895162-7895220 [-]
Database links

Mature sequence pal-miR-215-5p

Accession MIMAT0039828
Sequence

1 - 

augaccuaugaaucgacagaca

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence pal-miR-215-3p

Accession MIMAT0039829
Sequence

38 - 

ucugucauuucuauaggccaau

 - 59

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:25128405 "Characterisation of novel microRNAs in the Black flying fox (Pteropus alecto) by deep sequencing" Cowled C, Stewart CR, Likic VA, Friedlander MR, Tachedjian M, Jenkins KA, Tizard ML, Cottee P, Marsh GA, Zhou P, Baker ML, Bean AG, Wang LF BMC Genomics. 15:682(2014).