Stem-loop sequence pal-mir-378

AccessionMI0032325 (change log)
DescriptionPteropus alecto miR-378 stem-loop
Literature search

1 open access papers mention pal-mir-378
(1 sentences)

Stem-loop
   --  c      a       ugu      ccu 
5'   cu cugacu caggucc   guguua   c
     || |||||| |||||||   ||||||    
3'   ga gacuga guucagg   cacgau   g
   cg  a      g       --u      aaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM32557v1; GCA_000325575.1) Overlapping transcripts
KB030406.1: 1555836-1555895 [+]
intergenic
Database links

Mature sequence pal-miR-378-5p

Accession MIMAT0039782
Sequence

1 - 

cuccugacuacagguccugugu

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence pal-miR-378-3p

Accession MIMAT0039783
Sequence

39 - 

acuggacuuggagucagaaggc

 - 60

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:25128405 "Characterisation of novel microRNAs in the Black flying fox (Pteropus alecto) by deep sequencing" Cowled C, Stewart CR, Likic VA, Friedlander MR, Tachedjian M, Jenkins KA, Tizard ML, Cottee P, Marsh GA, Zhou P, Baker ML, Bean AG, Wang LF BMC Genomics. 15:682(2014).