Stem-loop sequence pal-let-7f

AccessionMI0032319 (change log)
DescriptionPteropus alecto let-7f stem-loop
Literature search

1 open access papers mention pal-let-7f
(1 sentences)

Stem-loop
   --u                       ---------       u 
5'    gagguaguagauuguauaguugu         gggguag g
      |||||||||||||||||||||||         ||||||| a
3'    uuccguuaucuaacauaucaaua         ucccauu u
   ccc                       gaggacuug       u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM32557v1; GCA_000325575.1) Overlapping transcripts
KB030244.1: 557861-557938 [+]
intergenic
Database links

Mature sequence pal-let-7f-5p

Accession MIMAT0039770
Sequence

1 - 

ugagguaguagauuguauaguu

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence pal-let-7f-3p

Accession MIMAT0039771
Sequence

57 - 

cuauacaaucuauugccuuccc

 - 78

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:25128405 "Characterisation of novel microRNAs in the Black flying fox (Pteropus alecto) by deep sequencing" Cowled C, Stewart CR, Likic VA, Friedlander MR, Tachedjian M, Jenkins KA, Tizard ML, Cottee P, Marsh GA, Zhou P, Baker ML, Bean AG, Wang LF BMC Genomics. 15:682(2014).