Stem-loop sequence hsa-mir-548bc

AccessionMI0032315 (change log)
DescriptionHomo sapiens miR-548bc stem-loop
Literature search

41 open access papers mention hsa-mir-548bc
(141 sentences)

Stem-loop
   -------------ucuu    uac         -                        uac 
5'                  uugu   agguuggug agaaguaaucgcgguuuuugccau   u
                    ||||   ||||||||| ||||||||||||||||||||||||    
3'                  aaua   uccaaccac uuuucauuagugucaaaaacggua   g
   auuaacuucugguuuau    uaa         g                        cuc 
Get sequence
Deep sequencing
3484 reads, 1.53 reads per million, 131 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr17: 39297400-39297509 [+]
intergenic
Database links

Mature sequence hsa-miR-548bc

Accession MIMAT0039765
Sequence

58 - 

aaaaacugugauuacuuuugc

 - 78

Get sequence
Deep sequencing1541 reads, 122 experiments
Evidence experimental; Illumina [1]

References

1
PMID:25215888 "Comparison of hepatocellular carcinoma miRNA expression profiling as evaluated by next generation sequencing and microarray" Murakami Y, Tanahashi T, Okada R, Toyoda H, Kumada T, Enomoto M, Tamori A, Kawada N, Taguchi YH, Azuma T PLoS One. 9:e106314(2014).