Stem-loop sequence ame-mir-2b

AccessionMI0031814 (change log)
DescriptionApis mellifera miR-2b stem-loop
Gene family MIPF0000049; mir-2
Literature search

4 open access papers mention ame-mir-2b
(10 sentences)

Stem-loop
   gac  ca      u     c   c         ----a  g 
5'    gc  cgcuca caaag ugg ugugauaug     ac c
      ||  |||||| ||||| ||| |||||||||     ||  
3'    cg  gcgagu guuuc acc acacuauac     ug u
   aca  ug      -     -   a         gacua  c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AMEL4.5; GCA_000002195.1) Overlapping transcripts
CM000054.5: 1246930-1247007 [-]
intergenic
Clustered miRNAs
< 10kb from ame-mir-2b
ame-mir-2-2CM000054.5: 1247873-1247956 [+]
ame-mir-2bCM000054.5: 1246930-1247007 [-]
ame-mir-2-1CM000054.5: 1246924-1247012 [+]
ame-mir-13bCM000054.5: 1246714-1246792 [+]
ame-mir-13aCM000054.5: 1246352-1246451 [+]
ame-mir-2-3CM000054.5: 1246071-1246170 [+]
ame-mir-71CM000054.5: 1245684-1245783 [+]
Database links

Mature sequence ame-miR-2b-5p

Accession MIMAT0037292
Sequence

11 - 

ucaucaaagcuggcugugauauga

 - 34

Get sequence
Evidence experimental; Illumina [1-2]

References

1
PMID:24136738 "The integrative analysis of microRNA and mRNA expression in Apis mellifera following maze-based visual pattern learning" Qin QH, Wang ZL, Tian LQ, Gan HY, Zhang SW, Zeng ZJ Insect Sci. 21:619-636(2014).
2
PMID:22409512 "Behavioral plasticity in honey bees is associated with differences in brain microRNA transcriptome" Greenberg JK, Xia J, Zhou X, Thatcher SR, Gu X, Ament SA, Newman TC, Green PJ, Zhang W, Robinson GE, Ben-Shahar Y Genes Brain Behav. 11:660-670(2012).