Stem-loop sequence rno-mir-486

AccessionMI0031787 (change log)
DescriptionRattus norvegicus miR-486 stem-loop
Gene family MIPF0000220; mir-486
Literature search

15 open access papers mention rno-mir-486
(135 sentences)

Stem-loop
   gca                      --  gag a 
5'    uccuguacugagcugccccgag  cu   c c
      ||||||||||||||||||||||  ||   | a
3'    aggacaugacucgacggggcuc  gg   g a
   ccc                      ca  -aa u 
Get sequence
Deep sequencing
42131766 reads, 2.32e+04 reads per million, 507 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence rno-miR-486

Accession MIMAT0037265
Sequence

4 - 

uccuguacugagcugccccgag

 - 25

Get sequence
Deep sequencing42091956 reads, 507 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23799049 "Distinctive profile of IsomiR expression and novel microRNAs in rat heart left ventricle" McGahon MK, Yarham JM, Daly A, Guduric-Fuchs J, Ferguson LJ, Simpson DA, Collins A PLoS One. 8:e65809(2013).