Stem-loop sequence rno-mir-676

AccessionMI0031786 (change log)
DescriptionRattus norvegicus miR-676 stem-loop
Gene family MIPF0000471; mir-676
Literature search

3 open access papers mention rno-mir-676
(6 sentences)

Stem-loop
   cuuca  -u         a   u    c        uu   gaauu 
5'      cc  gaaugcaug cuc gcaa cuuaggac  gca     a
        ||  ||||||||| ||| |||| ||||||||  |||      
3'      gg  uuugcguau gag uguu gaguccug  cgu     a
   ---cg  uc         c   c    c        -c   aagac 
Get sequence
Deep sequencing
250063 reads, 172 reads per million, 493 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chrX: 70207015-70207103 [+]
intergenic
Database links

Mature sequence rno-miR-676

Accession MIMAT0037264
Sequence

55 - 

ccguccugagcuugucgagcua

 - 76

Get sequence
Deep sequencing247400 reads, 493 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23799049 "Distinctive profile of IsomiR expression and novel microRNAs in rat heart left ventricle" McGahon MK, Yarham JM, Daly A, Guduric-Fuchs J, Ferguson LJ, Simpson DA, Collins A PLoS One. 8:e65809(2013).