Stem-loop sequence rno-mir-1b

AccessionMI0031785 (change log)
DescriptionRattus norvegicus miR-1b stem-loop
Gene family MIPF0000038; mir-1
Literature search

4 open access papers mention rno-mir-1b
(12 sentences)

Stem-loop
   -   -     gg c                gc     ---   a 
5'  ccu gcuug  a acauacuucuuuauau  ccaua   ugg c
    ||| |||||  | ||||||||||||||||  |||||   ||| c
3'  gga cggac  u uguaugaagaaaugua  gguau   auc u
   a   u     uu a                -a     cga   g 
Get sequence
Deep sequencing
526374 reads, 343 reads per million, 402 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr3: 175769716-175769800 [+]
intergenic
Database links

Mature sequence rno-miR-1b

Accession MIMAT0037263
Sequence

52 - 

uggaauguaaagaaguauguau

 - 73

Get sequence
Deep sequencing525159 reads, 401 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23799049 "Distinctive profile of IsomiR expression and novel microRNAs in rat heart left ventricle" McGahon MK, Yarham JM, Daly A, Guduric-Fuchs J, Ferguson LJ, Simpson DA, Collins A PLoS One. 8:e65809(2013).