Stem-loop sequence rno-mir-542-3

AccessionMI0031782 (change log)
DescriptionRattus norvegicus miR-542-3 stem-loop
Gene family MIPF0000185; mir-542
Literature search

9 open access papers mention rno-mir-542-3
(30 sentences)

Stem-loop
           g c    gg    uca         auacc 
5' ucucagac u ucgg  auca   ugucacgag     a
   |||||||| | ||||  ||||   |||||||||     c
3' agggucug a aguc  uagu   acaguguuc     u
           g a    aa    uag         acgcg 
Get sequence
Deep sequencing
92336 reads, 30.9 reads per million, 485 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chrX: 158588529-158588607 [+]
intergenic
Clustered miRNAs
< 10kb from rno-mir-542-3
rno-mir-322-2chrX: 158584542-158584636 [+]
rno-mir-503-2chrX: 158584857-158584927 [+]
rno-mir-351-2chrX: 158585587-158585667 [+]
rno-mir-542-3chrX: 158588529-158588607 [+]
rno-mir-450b-2chrX: 158589637-158589705 [+]
Database links

Mature sequence rno-miR-542-5p

Accession MIMAT0003178
Sequence

11 - 

cucggggaucaucaugucacga

 - 32

Get sequence
Deep sequencing57324 reads, 453 experiments
Evidence experimental; cloned [1-2], SOLiD [3]

Mature sequence rno-miR-542-3p

Accession MIMAT0003179
Sequence

49 - 

ugugacagauugauaacugaaa

 - 70

Get sequence
Deep sequencing219678 reads, 480 experiments
Evidence experimental; cloned [2], SOLiD [3]

References

1
PMID:16274478 "Identification of clustered microRNAs using an ab initio prediction method" Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ, Tuschl T, van Nimwegen E, Zavolan M BMC Bioinformatics. 6:267(2005).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).