Stem-loop sequence rno-mir-466b-4

AccessionMI0031780 (change log)
DescriptionRattus norvegicus miR-466b-4 stem-loop
Gene family MIPF0000316; mir-467
Literature search

15 open access papers mention rno-mir-466b-4
(113 sentences)

Stem-loop
   --ca         a               cc         ua 
5'     uguguguau uguguguguguaugu  augugugua  u
       ||||||||| |||||||||||||||  |||||||||   
3'     acgcauaua acauacacacauaca  uauacauau  g
   acga         c               --         ua 
Get sequence
Deep sequencing
4205 reads, 0.514 reads per million, 389 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr17: 72066536-72066617 [-]
intergenic
Clustered miRNAs
< 10kb from rno-mir-466b-4
rno-mir-466b-3chr17: 72069566-72069651 [-]
rno-mir-466b-4chr17: 72066536-72066617 [-]
rno-mir-466cchr17: 72060077-72060155 [-]
Database links

Mature sequence rno-miR-466b-5p

Accession MIMAT0005278
Previous IDsrno-miR-466b
Sequence

11 - 

uauguguguguguauguccaug

 - 32

Get sequence
Deep sequencing4728 reads, 293 experiments
Evidence experimental; cloned [1], SOLiD [2]

Mature sequence rno-miR-466b-4-3p

Accession MIMAT0037262
Sequence

50 - 

auauacauacacacauacaca

 - 70

Get sequence
Deep sequencing3015 reads, 351 experiments
Evidence experimental; SOLiD [2]
Predicted targets

References

1
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
2
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).