Stem-loop sequence rno-mir-466b-3

AccessionMI0031779 (change log)
DescriptionRattus norvegicus miR-466b-3 stem-loop
Gene family MIPF0000316; mir-467
Literature search

15 open access papers mention rno-mir-466b-3
(113 sentences)

Stem-loop
   --ca     a a             a   cca          u 
5'     ugugu u uaugugugugugu ugu   uguguguaua g
       ||||| | ||||||||||||| |||   ||||||||||  
3'     acacg a gugcacacacaua aca   acauacauau a
   acac     a c             c   cac          a 
Get sequence
Deep sequencing
2439 reads, 2.93 reads per million, 375 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr17: 72069566-72069651 [-]
intergenic
Clustered miRNAs
< 10kb from rno-mir-466b-3
rno-mir-466b-3chr17: 72069566-72069651 [-]
rno-mir-466b-4chr17: 72066536-72066617 [-]
rno-mir-466cchr17: 72060077-72060155 [-]
Database links

Mature sequence rno-miR-466b-5p

Accession MIMAT0005278
Previous IDsrno-miR-466b
Sequence

11 - 

uauguguguguguauguccaug

 - 32

Get sequence
Deep sequencing4728 reads, 293 experiments
Evidence experimental; cloned [1], SOLiD [2]

Mature sequence rno-miR-466b-3p

Accession MIMAT0017285
Previous IDsrno-miR-466b-1-3p
Sequence

46 - 

auacauacacacacacauacac

 - 67

Get sequence
Deep sequencing2502 reads, 311 experiments
Evidence experimental; SOLiD [2]

References

1
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
2
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).