Stem-loop sequence rno-mir-344b-3

AccessionMI0031778 (change log)
DescriptionRattus norvegicus miR-344b-3 stem-loop
Gene family MIPF0000267; mir-344
Literature search

8 open access papers mention rno-mir-344b-3
(36 sentences)

Stem-loop
   -   u     a    gc         u        u 
5'  uga caguc ggcu  ugguuauau ccaggacu c
    ||| ||||| ||||  ||||||||| |||||||| u
3'  auu gucag ccga  accaauaug gguccugg c
   a   -     c    -a         -        u 
Get sequence
Deep sequencing
17180 reads, 24.5 reads per million, 163 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr1: 121201252-121201322 [-]
intergenic
Clustered miRNAs
< 10kb from rno-mir-344b-3
rno-mir-344b-3chr1: 121201252-121201322 [-]
rno-mir-344b-1chr1: 121193138-121193235 [-]
Database links

Mature sequence rno-miR-344b-5p

Accession MIMAT0017811
Sequence

6 - 

agucaggcugcugguuauauuc

 - 27

Get sequence
Deep sequencing4129 reads, 84 experiments
Evidence experimental; SOLiD [1]

Mature sequence rno-miR-344b-3p

Accession MIMAT0017812
Previous IDsrno-miR-344b-2-3p
Sequence

47 - 

gguauaaccaaagcccgacugu

 - 68

Get sequence
Deep sequencing31594 reads, 158 experiments
Evidence experimental; SOLiD [1]

References

1
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).