Stem-loop sequence rno-mir-598-2

AccessionMI0031774 (change log)
DescriptionRattus norvegicus miR-598-2 stem-loop
Gene family MIPF0000393; mir-598
Literature search

2 open access papers mention rno-mir-598-2
(4 sentences)

Stem-loop
   -- c     c           c      ---u  g    ga 
5'   g ugaug uggcggugaug cgaugg    gc agcu  a
     | ||||| ||||||||||| ||||||    || ||||  a
3'   c acuac auugcuacugc gcuacu    cg ucgg  a
   ua u     u           u      gcau  -    gu 
Get sequence
Deep sequencing
83622 reads, 40.3 reads per million, 434 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr15: 47057496-47057574 [+]
sense
ENSRNOT00000015540 ; Xkr6-201; intron 1
ENSRNOT00000073058 ; Mir598-201; exon 1
Database links

Mature sequence rno-miR-598-5p

Accession MIMAT0005324
Sequence

11 - 

gcggugaugccgauggugcgag

 - 32

Get sequence
Deep sequencing642 reads, 94 experiments
Evidence experimental; cloned [1], SOLiD [2]

Mature sequence rno-miR-598-3p

Accession MIMAT0005325
Sequence

48 - 

uacgucaucgucgucaucguua

 - 69

Get sequence
Deep sequencing166598 reads, 434 experiments
Evidence experimental; cloned [1], SOLiD [2]

References

1
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
2
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).