Stem-loop sequence rno-mir-450b-2

AccessionMI0031772 (change log)
DescriptionRattus norvegicus miR-450b-2 stem-loop
Gene family MIPF0000128; mir-450
Stem-loop
          uuu     u            ug ac 
5' gaacuau   ugcga guguuccuaaua  u  u
   |||||||   ||||| ||||||||||||  |  a
3' cuuggua   acgcu cgcagggguuau  g  u
          cuu     u            gu ag 
Get sequence
Deep sequencing
537342 reads, 363 reads per million, 494 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chrX: 158589637-158589705 [+]
sense
Clustered miRNAs
< 10kb from rno-mir-450b-2
rno-mir-322-2chrX: 158584542-158584636 [+]
rno-mir-503-2chrX: 158584857-158584927 [+]
rno-mir-351-2chrX: 158585587-158585667 [+]
rno-mir-542-3chrX: 158588529-158588607 [+]
rno-mir-450b-2chrX: 158589637-158589705 [+]
Database links

Mature sequence rno-miR-450b-5p

Accession MIMAT0035746
Sequence

8 - 

uuuugcgauguguuccuaaua

 - 28

Get sequence
Deep sequencing1069018 reads, 494 experiments
Evidence experimental; RNAseq-metaanalysis [1]

Mature sequence rno-miR-450b-3p

Accession MIMAT0035747
Sequence

43 - 

auuggggacgcuucgcauuca

 - 63

Get sequence
Deep sequencing5666 reads, 313 experiments
Evidence experimental; RNAseq-metaanalysis [1]

References

1
PMID:23329697 "Rat mir-155 generated from the lncRNA Bic is 'hidden' in the alternate genomic assembly and reveals the existence of novel mammalian miRNAs and clusters" Uva P, Da Sacco L, Del Corno M, Baldassarre A, Sestili P, Orsini M, Palma A, Gessani S, Masotti A RNA. 19:365-379(2013).