Stem-loop sequence rno-mir-196b-2

AccessionMI0031760 (change log)
DescriptionRattus norvegicus miR-196b-2 stem-loop
Gene family MIPF0000031; mir-196
Literature search

9 open access papers mention rno-mir-196b-2
(39 sentences)

Stem-loop
   -      uc      uu       u  c           ucca 
5'  aacugg  ggugau  agguagu uc uguuguuggga    c
    ||||||  ||||||  ||||||| || |||||||||||     
3'  uugacu  ucauua  uccguca ag acgacagcucu    c
   g      --      cu       c  c           cuuu 
Get sequence
Deep sequencing
248433 reads, 170 reads per million, 401 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

miR-196b is predicted based on sequence homology to miR-196a [1]. Yekta et al. report that miR-196 miRNAs are expressed from HOX gene clusters in mammals, and that HOX genes in these clusters are targets of miR-196. Indeed, HOXB8 mRNA was shown to be a natural target for miR-196-directed cleavage through a perfectly complementary miR-target site. Other HOX genes have imperfect miR-196 complementary sites indicative of regulation by translational repression [1]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The ends of the miRNA may be offset with respect to previous annotations.

Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr4: 82284851-82284935 [-]
antisense
ENSRNOT00000066360 ; RGD1564419-201; intron 1
Database links

Mature sequence rno-miR-196b-5p

Accession MIMAT0001082
Previous IDsrno-miR-196b
Sequence

16 - 

uagguaguuuccuguuguuggg

 - 37

Get sequence
Deep sequencing494534 reads, 401 experiments
Evidence experimental; cloned [2], SOLiD [3]

Mature sequence rno-miR-196b-3p

Accession MIMAT0017171
Previous IDsrno-miR-196b*
Sequence

51 - 

ucgacagcacgacacugccuuca

 - 73

Get sequence
Deep sequencing2332 reads, 145 experiments
Evidence experimental; SOLiD [3]

References

1
PMID:15105502 "MicroRNA-directed cleavage of HOXB8 mRNA" Yekta S, Shih IH, Bartel DP Science. 304:594-596(2004).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).