Stem-loop sequence rno-mir-190a-2

AccessionMI0031759 (change log)
DescriptionRattus norvegicus miR-190-2 stem-loop
Gene family MIPF0000076; mir-190
Literature search

7 open access papers mention rno-mir-190a-2
(7 sentences)

Stem-loop
   u     c u    - ug               ua     uuau 
5'  gcagg c cugu g  auauguuugauauau  gguug    u
    ||||| | |||| |  |||||||||||||||  |||||     
3'  cguuc g gaca c  uauacgaacuauaua  ucaac    u
   c     u u    u cu               --     cuaa 
Get sequence
Deep sequencing
24923 reads, 0 reads per million, 450 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr8: 80928165-80928249 [+]
intergenic
Database links

Mature sequence rno-miR-190a-5p

Accession MIMAT0000865
Previous IDsrno-miR-190
Sequence

15 - 

ugauauguuugauauauuaggu

 - 36

Get sequence
Deep sequencing47000 reads, 447 experiments
Evidence experimental; SOLiD [2]

Mature sequence rno-miR-190a-3p

Accession MIMAT0017145
Previous IDsrno-miR-190*
Sequence

51 - 

acuauauaucaagcauauuccu

 - 72

Get sequence
Deep sequencing2846 reads, 288 experiments
Evidence experimental; SOLiD [2]

References

1
PMID:12554859 "New microRNAs from mouse and human" Lagos-Quintana M, Rauhut R, Meyer J, Borkhardt A, Tuschl T RNA. 9:175-179(2003).
2
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).