Stem-loop sequence mmu-mir-466c-3

AccessionMI0031753 (change log)
DescriptionMus musculus miR-466c-3 stem-loop
Gene family MIPF0000208; mir-466
Literature search

27 open access papers mention mmu-mir-466c-3
(62 sentences)

Stem-loop
   u    --         -g           c     ca      aau 
5'  gugu  auauguguu  augugugugug augua  uaugug   a
    ||||  |||||||||  ||||||||||| |||||  ||||||   u
3'  cacg  uauacacag  uacacacgcac uacau  auacau   g
   a    ag         aa           a     --      aua 
Get sequence
Deep sequencing
33823 reads, 138 reads per million, 104 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr2: 10491336-10491425 [+]
sense
OTTMUST00000026263 ; Sfmbt2-001; intron 10
ENSMUST00000041105 ; Sfmbt2-001; intron 10
ENSMUST00000116594 ; Sfmbt2-201; intron 11
Clustered miRNAs
< 10kb from mmu-mir-466c-3
mmu-mir-466c-1chr2: 10481534-10481617 [+]
mmu-mir-669a-5chr2: 10481761-10481847 [+]
mmu-mir-467a-3chr2: 10483678-10483760 [+]
mmu-mir-466c-2chr2: 10483966-10484055 [+]
mmu-mir-669a-6chr2: 10484196-10484282 [+]
mmu-mir-467a-4chr2: 10486135-10486217 [+]
mmu-mir-466b-4chr2: 10486423-10486512 [+]
mmu-mir-669a-7chr2: 10486653-10486739 [+]
mmu-mir-467a-5chr2: 10488599-10488681 [+]
mmu-mir-466b-5chr2: 10488887-10488974 [+]
mmu-mir-669p-1chr2: 10489116-10489202 [+]
mmu-mir-467a-6chr2: 10491048-10491130 [+]
mmu-mir-466c-3chr2: 10491336-10491425 [+]
mmu-mir-669a-8chr2: 10491566-10491652 [+]
mmu-mir-467a-7chr2: 10493510-10493592 [+]
mmu-mir-466b-6chr2: 10493798-10493887 [+]
mmu-mir-669a-9chr2: 10494028-10494114 [+]
mmu-mir-467a-8chr2: 10495980-10496062 [+]
mmu-mir-466b-7chr2: 10496268-10496355 [+]
mmu-mir-669p-2chr2: 10496497-10496583 [+]
mmu-mir-467a-9chr2: 10498393-10498475 [+]
mmu-mir-466b-2chr2: 10498685-10498766 [+]
mmu-mir-669a-10chr2: 10498911-10498997 [+]
mmu-mir-669a-11chr2: 10501339-10501425 [+]
Database links

Mature sequence mmu-miR-466c-5p

Accession MIMAT0004877
Sequence

14 - 

ugaugugugugugcauguacauau

 - 37

Get sequence
Deep sequencing31110 reads, 95 experiments
Evidence experimental; Illumina [1]

Mature sequence mmu-miR-466c-3p

Accession MIMAT0004878
Sequence

55 - 

auacauacacgcacacauaaga

 - 76

Get sequence
Deep sequencing70338 reads, 102 experiments
Evidence experimental; Illumina [1]

References

1
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).