Stem-loop sequence ata-MIR9674b

AccessionMI0031731
DescriptionAegilops tauschii miR9674b stem-loop
Gene family MIPF0001917; MIR9674
Stem-loop
   ggcggcugcugcugccccacgauggguaggaug  c              c    acccgauguucgugccacaccgcguccgu 
5'                                  gc ggugcuauggauag uuca                             c
                                    || |||||||||||||| ||||                              
3'                                  cg cuacgauaccuguu aagu                             g
   ------------------------ugccggcca  a              u    cggucuccuaaccgagggacgaacugagu 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM34733v1) Overlapping transcripts
KD564249.1: 7297-7442 [-]
intergenic

Mature sequence ata-miR9674b-5p

Accession MIMAT0037256
Sequence

37 - 

ggugcuauggauagcuucaac

 - 57

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ata-miR9674b-3p

Accession MIMAT0037257
Sequence

116 - 

ugaauuuguccauagcaucag

 - 136

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23535592 "Aegilops tauschii draft genome sequence reveals a gene repertoire for wheat adaptation" Jia J, Zhao S, Kong X, Li Y, Zhao G, He W, Appels R, Pfeifer M, Tao Y, Zhang X, Jing R, Zhang C, Ma Y, Gao L, Gao C, Spannagl M, Mayer KF, Li D, Pan S, Zheng F, Hu Q, Xia X, Li J, Liang Q, Chen J, Wicker T, Gou C, Kuang H, He G, Luo Y, Keller B, Xia Q, Lu Nature. 496:91-95(2013).